European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-EVE-DC-001;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier FLO-40644-6
Description
Description Qualitative PCR method for detection of carnation event 123-2-38 (verified by the CRL GMFF in the context of Commission Decision 2007/364/EC).
Keywords event_specific, EU-RL_GMFF_in-house_verified.
Comment
NOTE: This GMO was formerly referred to with the Unique identifier (UI) (FLO-40644-4) which OECD corrected (JAN 2015).
From Dianthus caryophyllus (carnation)- event 123.2.38 (FLO-40644-6)
References
1 Savini C., Querci M., Moens W., Mazzara M., Cordeil S., Van den Eede G.; "Report on the Testing of a PCR-based Detection Method for Identification of FlorigeneTM Moonlite GM Carnation - Protocol CRLEM03/06VR. Version 2" Online Publication (2007)
EURL_2001 CRL_Report_Flor_Moonlite_v2.pdf
Reference Position 1-375
2 "PCR reactions set up and amplification conditions" Online Publication (2016)
PCR QL-EVE-DC-001.pdf
Reference Position 1-375
Cross-references
GMOMETHODS QL-TAX-DC-001;
Features
Key Location Qualifier Value
STS 1..375 standard_namePCR 375 bp amplicon
noteEvent-specific PCR
target5' integration border region (IBR) between the insert of carnation event 123.2.38 and the carnation host genome
primer_b 1..20 standard_namePrimer forward: LB123.2.38-R
noteCAATGCCTCGCCTTTTGTGG
target5'-host genome
primer_b complement(356..375) standard_namePrimer reverse: LB inside.R
noteACGTGAATGTAGACACGTCG
targetinsert
Sequence information
Length: 375 BP, A Count: 130, C Count: 52, T Count: 122, G Count: 71
caatgcctcg ccttttgtgg nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       180
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       240
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       300
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnncgacg       360
tgtctacatt cacgt                                                        375