European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-EVE-CP-001;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier
Description
Description Qualitative PCR method for detection of papaya event Huanong N 1 (Wei et al., 2016).
Keywords event_specific.
From Carica papaya (papaya) - event Huanong No. 1
References
1 Wei J., Le H., Pan A., Xu J., Li F., Li X., Quan S., Guo J., Yang L.; "Collaborative trial for the validation of event-specific PCR detection methods of genetically modified papaya Huanong No. 1" Food Chemistry 194:20-25 (2016)
DOI 10.1016/j.foodchem.2015.07.010
Reference Position 1-285
2 "PCR reactions set up and amplification conditions" Online Publication (2016)
PCR QL-EVE-CP-001.pdf
Reference Position 1-285
Features
Key Location Qualifier Value
STS 1..285 standard_namePCR 285 bp amplicon
noteEvent-specific PCR
target5' integration border region (IBR) between the insert of papaya event Huanong No 1 and the papaya host genome
primer_b 1..22 standard_namePrimer forward: HN-F
noteATTGACGAGTACAAGGAGACGC
target5'-host genome
misc_fea complement(137..228) notenptII fragment
misc_fea 229..285 noteBinary vector pBI121 fragment. Identical to Genbank:AF485783 (2476-5826)
primer_b complement(265..285) standard_namePrimer reverse: HN-R
noteCTCCGCTCATGATCAGATTGT
targetinsert
Sequence information
Length: 285 BP, A Count: 100, C Count: 59, T Count: 73, G Count: 53
attgacgagt acaaggagac gccttttaat ttgtttaaat taaataaaaa cataaattat        60
taagcgacgt aataataaac acgtcataaa ttttttcaaa aaataaaatt tcttttattt       120
tctaaaaagt agttgattcg cccaatagca gccagtccct tcccgcttca gtgacaacgt       180
cgagcacagc tgcgcaagga acgcccgtcg tggccagcca cgatagcctc aaacactgat       240
agtttaaact gaaggcggga aacgacaatc tgatcatgag cggag                       285