European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-ELE-00-031;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier
Description
Description Qualitative LAMP method for detection of Figwort Mosaic Virus 35S promoter (Li et al., 2019).
Keywords element_specific.
1 Li R., Shi J., Liu B., Wang C., Zhang D., Zhao X.; "Inter-laboratory validation of visual loop-mediated isothermal amplification assays for GM contents screening" Food Chemistry 274:659-663 (2019)
DOI 10.1016/j.foodchem.2018.07.010
Reference Position 1-184
2 Wang C., Li R., Quan S., Shen P., Zhang D., Shi J., Yang L.; "GMO detection in food and feed through screening by visual loop-mediated isothermal amplification assays" Anal. and Bioanal. Chem. 407:4829-4834(2015)
DOI 10.1007/s00216-015-8652-z
Reference Position 1-184
3 "PCR reactions set up and amplification conditions" Online Publication (2018)
PCR QL-ELE-00-031.pdf
Reference Position 1-184
Features
Key Location Qualifier Value
STS 1..184 standard_nameLAMP 184 bp amplicon
noteelement-specific LAMP assay
targetFigwort Mosaic Virus 35S promoter (P-FMV)
primer_b 1..19 standard_namePrimer forward: P-FMV35S F3
noteGTCAGGGTACAGAGTCTCC
targetP-FMV
primer_b join(complement(66..87), 22..41) standard_namePrimer: P-FMV35S FIP
noteGCTGGAACAGTAGTTTACTTTGACCATTAGCCAAAAGCTACA
primer_b 22..41 noteACCATTAGCCAAAAGCTACA
targetFMV35S F2
primer_b complement(42..65) standard_namePrimer: P-FMV35S loop F (complementary to the sequence between F1 and F2)
noteATTGAAGATTCTTCATTGATCTCC
primer_b complement(66..87) noteGCTGGAACAGTAGTTTACTTTG
targetP-FMV35S F1c (complimentary to F1)
primer_b join(88..105, complement(145..168)) standard_namePrimer: P-FMV35S BIP
noteACATGCATGGTCAGTAAGATTACTTTCAAAGATGCCCAC
primer_b 88..105 noteACATGCATGGTCAGT
targetP-FMV35S B1c (complementary to B1) (according to the sequence of the FMV genome the BIP primer is missing the TCA nucleotides in position 96-98 of the amplicon)
primer_b 108..144 standard_namePrimer: P-FMV35S loop B (complementary to the sequence between B1 and B2)
noteGTTTCAGAAAAAGACATCCACCGAAGACTTAAAGTTA
primer_b complement(145..168) noteAAGATTACTTTCAAAGATGCCCAC
targetFMV35S B2
primer_b complement(167..184) standard_namePrimer reverse: P-FMV35S B3
noteGCTGCTCGATGTTGACAA
targetP-FMV
Sequence information
Length: 184 BP, A Count: 67, C Count: 39, T Count: 42, G Count: 36
gtcagggtac agagtctccn naccattagc caaaagctac aggagatcaa tgaagaatct        60
tcaatcaaag taaactactg ttccagcaca tgcatcatgg tcagtnngtt tcagaaaaag       120
acatccaccg aagacttaaa gttagtgggc atctttgaaa gtaatcttgt caacatcgag       180
cagc                                                                    184