European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-ELE-00-030;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier
Description
Description Qualitative LAMP method for detection of Cry1Ac gene (Li et al., 2018).
Keywords element_specific.
1 Li R., Shi J., Liu B., Zhang D., Zhao X., Yang L.; "International collaborative ring trial of four gene-specific loop-mediated isothermal amplification assays in GMO analysis" Food Control 84:278-283 (2018)
DOI 10.1016/j.foodcont.2017.08.012
Reference Position 1-197
2 Wang C., Li R., Quan S., Shen P., Zhang D., Shi J., Yang L.; "GMO detection in food and feed through screening by visual loop-mediated isothermal amplification assays" Anal. and Bioanal. Chem. 407:4829-4834(2015)
DOI 10.1007/s00216-015-8652-z
Reference Position 1-197
3 "PCR reactions set up and amplification conditions" Online Publication (2017)
PCR QL-ELE-00-030.pdf
Reference Position 1-197
Features
Key Location Qualifier Value
STS 1..197 standard_nameLAMP 197 bp amplicon
noteelement-specific LAMP assay
targetCry1Ac modified gene derived from Bacillus thuringiensis
primer_b 1..18 standard_namePrimer forward: cry1Ac F3
noteGAGGCCAAAGAGTCCGTG
targetcry1Ac
primer_b join(21..41, complement(68..87)) standard_namePrimer: cry1Ac FIP
noteGGCGTGGATCATGGCGATGTTGCTTTGTTCGGGAACTCCC A
primer_b 21..41 noteTGCTTTGTTCGGGAACTCCCA
targetcry1Ac F2 (in position 32 the sequence of the amplicon includes an oligonucleotide T instead of oligonucleotide G of the primer sequence)
primer_b complement(43..65) standard_namePrimer: cry1Ac loop F (complementary to the sequence between F1 and F2)
noteGTGTCGGCTTGCAACTGATCATA
primer_b complement(68..87) noteGGCGTGGATCATGGCGATGT
targetcry1Ac F1c (complementary to F1)
primer_b join(96..117, complement(157..174)) standard_namePrimer: cry1Ac BIP
noteACGTGTGCACAGCATTCGTGAGTTCCTCGAAGATGGCAGC
primer_b 96..117 noteACGTGTGCACAGCATTCGTGAG
targetcry1Ac B1c (complementary to B1)
primer_b 127..148 standard_namePrimer: cry1Ac loop B (complementary to the sequence between B1 and B2)
noteCCTGAGTTGTCCGTGATCCCTG
primer_b complement(157..174) noteTTCCTCGAAGATGGCAGC
targetcry1Ac B2
primer_b complement(178..197) standard_namePrimer reverse: cry1Ac B3
noteGCGGTAAAGATACGTCCCTC
targetcry1Ac
Sequence information
Length: 197 BP, A Count: 45, C Count: 54, T Count: 47, G Count: 51
gaggccaaag agtccgtgnn tgctttgttc gtgaactccc antatgatca gttgcaagcc        60
gacacnnaca tcgccatgat ccacgccnnn nnnnnacgtg tgcacagcat tcgtgagnnn       120
nnnnnncctg agttgtccgt gatccctgnn nnnnnngctg ccatcttcga ggaannngag       180
ggacgtatct ttaccgc                                                      197