Entry information |
Entry name | QL-ELE-00-029; See in JRC GMO-Matrix See in JRC GMO-Amplicons |
GMO Unique Identifier | |
Description |
Description | Qualitative LAMP method for detection of CP4 epsps gene (Li et al., 2018). |
Keywords | element_specific. |
1 | Li R., Shi J., Liu B., Zhang D., Zhao X., Yang L.; "International collaborative ring trial of four gene-specific loop-mediated isothermal amplification assays in GMO analysis" Food Control 84:278-283 (2018) |
2 | Wang C., Li R., Quan S., Shen P., Zhang D., Shi J., Yang L.; "GMO detection in food and feed through screening by visual loop-mediated isothermal amplification assays" Anal. and Bioanal. Chem. 407:4829-4834(2015) |
3 | "PCR reactions set up and amplification conditions" Online Publication (2017) |
Features |
Key | Location | Qualifier | Value | STS | 1..204 | standard_name | LAMP 204 bp amplicon | note | element-specific LAMP assay | target | CP4 epsps gene from Agrobacterium tumefaciens type I and II | primer_b | 1..19 | standard_name | Primer forward: CP4 epsps F3 | note | CTTGCGTGGACCAAAGACT | target | CP4 epsps | primer_b | join(20..38, complement(60..81)) | standard_name | Primer: CP4 epsps FIP | note | AGCAGAACAGCGGACTTCACTTCCAACGCCAATCACCTACA | primer_b | 20..38 | note | CCAACGCCAATCACCTACA | target | CP4 epsps F2 | primer_b | omplement(39..59) | standard_name | Primer: CP4 epsps loop F (complementary to the sequence between F1 and F2) | note | GAGCGGAAGCCATAGGTACCC | primer_b | complement(60..81) | note | AGCAGAACAGCGGACTTCACTT | target | CP4 epsps F1c (complementary to F1) | primer_b | join(93..114, complement(152..171)) | standard_name | Primer: CP4 epsps BIP | primer_b | 93..114 | note | ACACCCCAGGTATCACCACTGT | target | CP4 epsps B1c (complementary to B1) | primer_b | 15..151 | standard_name | Primer: CP4 epsps loop B (complementary to the sequence between B1 and B2) | note | TATCGAGCCAATCATGACTCGTGACCACACTGAAAAG | primer_b | complement(152..171) | note | GCACCAAAACCTTGAAGCAT | target | CP4 epsps B2 | primer_b | complement(186..204) | standard_name | Primer reverse: CP4 epsps B3 | target | CP4 epsps |
|
Sequence information |
Length: 204 BP, A Count: 48, C Count: 58, T Count: 52, G Count: 46 |
cttgcgtgga ccaaagactc caacgccaat cacctacagg gtacctatgg cttccgctca 60
agtgaagtcc gctgttctgc tnnnnnnnnn nnacacccca ggtatcacca ctgttatcga 120
gccaatcatg actcgtgacc acactgaaaa gatgcttcaa ggttttggtg cnnnnnnnnn 180
nnnnnagact gatgctgacg gtgt 204
|