European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-ELE-00-029;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier
Description
Description Qualitative LAMP method for detection of CP4 epsps gene (Li et al., 2018).
Keywords element_specific.
1 Li R., Shi J., Liu B., Zhang D., Zhao X., Yang L.; "International collaborative ring trial of four gene-specific loop-mediated isothermal amplification assays in GMO analysis" Food Control 84:278-283 (2018)
DOI 10.1016/j.foodcont.2017.08.012
Reference Position 1-204
2 Wang C., Li R., Quan S., Shen P., Zhang D., Shi J., Yang L.; "GMO detection in food and feed through screening by visual loop-mediated isothermal amplification assays" Anal. and Bioanal. Chem. 407:4829-4834(2015)
DOI 10.1007/s00216-015-8652-z
Reference Position 1-204
3 "PCR reactions set up and amplification conditions" Online Publication (2017)
PCR QL-ELE-00-029.pdf
Reference Position 1-204
Features
Key Location Qualifier Value
STS 1..204 standard_nameLAMP 204 bp amplicon
noteelement-specific LAMP assay
targetCP4 epsps gene from Agrobacterium tumefaciens type I and II
primer_b 1..19 standard_namePrimer forward: CP4 epsps F3
noteCTTGCGTGGACCAAAGACT
targetCP4 epsps
primer_b join(20..38, complement(60..81)) standard_namePrimer: CP4 epsps FIP
noteAGCAGAACAGCGGACTTCACTTCCAACGCCAATCACCTACA
primer_b 20..38 noteCCAACGCCAATCACCTACA
targetCP4 epsps F2
primer_b omplement(39..59) standard_namePrimer: CP4 epsps loop F (complementary to the sequence between F1 and F2)
noteGAGCGGAAGCCATAGGTACCC
primer_b complement(60..81) noteAGCAGAACAGCGGACTTCACTT
targetCP4 epsps F1c (complementary to F1)
primer_b join(93..114, complement(152..171)) standard_namePrimer: CP4 epsps BIP
primer_b 93..114 noteACACCCCAGGTATCACCACTGT
targetCP4 epsps B1c (complementary to B1)
primer_b 15..151 standard_namePrimer: CP4 epsps loop B (complementary to the sequence between B1 and B2)
noteTATCGAGCCAATCATGACTCGTGACCACACTGAAAAG
primer_b complement(152..171) noteGCACCAAAACCTTGAAGCAT
targetCP4 epsps B2
primer_b complement(186..204) standard_namePrimer reverse: CP4 epsps B3
targetCP4 epsps
Sequence information
Length: 204 BP, A Count: 48, C Count: 58, T Count: 52, G Count: 46
cttgcgtgga ccaaagactc caacgccaat cacctacagg gtacctatgg cttccgctca        60
agtgaagtcc gctgttctgc tnnnnnnnnn nnacacccca ggtatcacca ctgttatcga       120
gccaatcatg actcgtgacc acactgaaaa gatgcttcaa ggttttggtg cnnnnnnnnn       180
nnnnnagact gatgctgacg gtgt                                              204