European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-ELE-00-028;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier
Description
Description Qualitative LAMP method for detection of phosphinothricin N-acetyltransferase (pat) gene (Li et al., 2018).
Keywords element_specific.
1 Li R., Shi J., Liu B., Zhang D., Zhao X., Yang L.; "International collaborative ring trial of four gene-specific loop-mediated isothermal amplification assays in GMO analysis" Food Control 84:278-283 (2018)
DOI 10.1016/j.foodcont.2017.08.012
Reference Position 1-199
2 Wang C., Li R., Quan S., Shen P., Zhang D., Shi J., Yang L.; "GMO detection in food and feed through screening by visual loop-mediated isothermal amplification assays" Anal. and Bioanal. Chem. 407:4829-4834(2015)
DOI 10.1007/s00216-015-8652-z
Reference Position 1-199
3 "PCR reactions set up and amplification conditions" Online Publication (2017)
PCR QL-ELE-00-028.pdf
Reference Position 1-199
Features
Key Location Qualifier Value
STS 1..199 standard_nameLAMP 199 bp amplicon
noteelement-specific LAMP assay
targetphosphinothricin N-acetyltransferase (pat) gene from Streptomyces viridochromogenes
primer_b 1..20 standard_namePrimer forward: pat F3
noteGGCGCAAGGTTTTAAGTCTG
targetpat
primer_b join(32..51, complement(76..95)) standard_namePrimer: pat FIP
noteTACCCCGGGCTGTGTATCCCATAGGCCTTCCAAACGATCC
primer_b 32..51 noteATAGGCCTTCCAAACGATCC
targetpat F2
primer_b complement(52..74) standard_namePrimer: pat lool F (complementary to the sequence between F1 and F2)
noteAAGCCTCATGCAACCTAACAGAT
primer_b complement(76..95) noteTACCCCGGGCTGTGTATCCC
targetpat F1c (complementary to F1)
primer_b join(97..117, complement(160..177)) standard_namePrimer: pat BIP
noteATTGCGCGCAGCTGGATACAAGGAGGAGCTGGCAACTCA
primer_b 97..117 noteATTGCGCGCAGCTGGATACAA
targetpat B1c (complementary to B1)
primer_b 118..156 standard_namePrimer: pat lool B (complementary to the sequence between B1 and B2)
noteGCATGGTGGATGGCATGATGTTGGTTTTTGGCAAAGGGA
primer_b complement(160..177) noteGGAGGAGCTGGCAACTCA
targetpat B2
primer_b complement(181..199) standard_namePrimer reverse: pat B3
noteGGTAACTGGCCTAACTGGC
targetpat
Sequence information
Length: 199 BP, A Count: 41, C Count: 41, T Count: 56, G Count: 61
ggcgcaaggt tttaagtctg nnnnnnnnnn nataggcctt ccaaacgatc catctgttag        60
gttgcatgag gcttngggat acacagcccg gggtanattg cgcgcagctg gatacaagca       120
tggtggatgg catgatgttg gtttttggca aagggannnt gagttgccag ctcctccnnn       180
gccagttagg ccagttacc                                                    199