European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-ELE-00-027;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier
Description
Description Qualitative LAMP method for detection of phosphinothricin N-acetyltransferase (bar) gene (Li et al., 2018).
Keywords element_specific.
1 Li R., Shi J., Liu B., Zhang D., Zhao X., Yang L.; "International collaborative ring trial of four gene-specific loop-mediated isothermal amplification assays in GMO analysis" Food Control 84:278-283 (2018)
DOI 10.1016/j.foodcont.2017.08.012
Reference Position 1-223
2 Wang C., Li R., Quan S., Shen P., Zhang D., Shi J., Yang L.; "GMO detection in food and feed through screening by visual loop-mediated isothermal amplification assays" Anal. and Bioanal. Chem. 407:4829-4834(2015)
DOI 10.1007/s00216-015-8652-z
Reference Position 1-223
3 "PCR reactions set up and amplification conditions" Online Publication (2017)
PCR QL-ELE-00-027.pdf
Reference Position 1-223
Features
Key Location Qualifier Value
STS 1..223 standard_nameLAMP 223 bp amplicon
noteelement-specific LAMP assay
targetPhosphinothricin N-acetyl transferase (bar) gene from bacterium Streptomyces hygroscopicus
primer_b 1..15 standard_namePrimer forward: bar F3
noteTGCATGCGCACGCTC
targetbar
primer_b join(21..36, complement(61..82)) standard_namePrimer: bar FIP
noteTGCTGAAGTCCCTGGAGGCACAGTTGGGCAGCCCGATG
primer_b 21..36 noteGTTGGGCAGCCCGATG
targetbar F2
primer_b complement(37..60) standard_namePrimer: bar loop F (complementary to the sequence between F1 and F2)
noteGGGCTTCAAGAGCGTGGTCGCTGT
primer_b complement(61..82) noteTGCTGAAGTCCCTGGAGGCACA
targetbar F1c (complimentary to F1)
primer_b join (121..139), complement(174..189)) standard_namePrimer: bar BIP
noteTGGCGGGGGGAGACGTACAGGGTCCCTGGAAGGCA
primer_b 121..139 noteTGGCGGGGGGAGACGTACA
targetbar B1c (complementary to B1)
primer_b 140..173 standard_namePrimer: bar loop B (complementary to the sequence between B1 and B2) note in the amplicon sequence in position 144 is present a C nucleotide instead of the T nucleotide of the primer sequence
noteCGGTTGACTCGGCCGTCCAGTCGTAGGCGTTGCG
primer_b complement(174..189) noteGGGTCCCTGGAAGGCA
targetbar B2 (according to the sequence of the amplicon in position 186 the BIP primer present a complimentary T nucletide instead of a complementary C)
primer_b complement(208..223) standard_namePrimer reverse: bar B3
noteAGGTGGACGGCGAGGT
targetbar
Sequence information
Length: 223 BP, A Count: 30, C Count: 73, T Count: 39, G Count: 81
tgcatgcgca cgctcnnnnn gttgggcagc ccgatgacag cgaccacgct cttgaagccc        60
tgtgcctcca gggacttcag cannnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
tggcgggggg agacgtacac ggtcgactcg gccgtccagt cgtaggcgtt gcgtgccttc       180
caggggcccn nnnnnnnnnn nnnnnnnacc tcgccgtcca cct                         223