European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-ELE-00-025;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier
Description
Description Qualitative duplex PCR method for detection of pat gene; bar gene (partim pat) (Debode et al., 2016).
Keywords element_specific.
1 Debode F., Huber I., Macarthur R., Rischitor P.E., Mazzara M., Herau V., Sebah D., Dobnik D., Broeders S., Roosens N.H., Busch U., Berben G., Morisset D., Zel J.; "Inter-laboratory studies for the validation of two singleplex (tE9 and pea lectin) and one duplex (pat/bar) real-time PCR methods for GMO detection" Food Control 73:452-461 (2016)
DOI 10.1016/j.foodcont.2016.08.037
Reference Position 1-108
2 "PCR reactions set up and amplification conditions" Online Publication (2016)
PCR QL-ELE-00-025.pdf
Reference Position 1-108
Features
Key Location Qualifier Value
STS 1..108 standard_namePCR 108 bp amplicon
noteelement-specific RT-PCR
targetphosphinothricin N-acetyltransferase (pat) gene from bacterium Streptomyces viridochromogenes
primer_b 1..22 standard_namePrimer forward: Pat-F
noteCGCGGTTTGTGATATCGTTAAC
targetpat
primer_b 53..81 standard_nameRT-PCR probe: Pat-P
noteHEX-AGGACAGAGCCACAAACACCACAAGAGTG-BBQ
primer_b complement(84..108) standard_namePrimer reverse: Pat-R
noteTCTTGCAACCTCTCTAGATCATCAA
targetpat
Sequence information
Length: 108 BP, A Count: 35, C Count: 20, T Count: 26, G Count: 27
cgcggtttgt gatatcgtta accattacat tgagacgtct acagtgaact ttaggacaga        60
gccacaaaca ccacaagagt ggattgatga tctagagagg ttgcaaga                    108