European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-ELE-00-024;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier
Description
Description Qualitative PCR method for detection of tE9 terminator (Debode et al., 2016).
Keywords element_specific.
1 Debode F., Huber I., Macarthur R., Rischitor P.E., Mazzara M., Herau V., Sebah D., Dobnik D., Broeders S., Roosens N.H., Busch U., Berben G., Morisset D., Zel J.; "Inter-laboratory studies for the validation of two singleplex (tE9 and pea lectin) and one duplex (pat/bar) real-time PCR methods for GMO detection" Food Control 73:452-461 (2017)
DOI 10.1016/j.foodcont.2016.08.037
Reference Position 1-87
2 "PCR reactions set up and amplification conditions" Online Publication (2016)
PCR QL-ELE-00-024.pdf
Reference Position 1-87
Features
Key Location Qualifier Value
STS 1..87 standard_namePCR 87 bp amplicon
noteelement-specific PCR
targetTerminator of the pea ribulose-1,5-bisphosphate carboxylase small subunit (rbcS) E9 gene
primer_b 1..23 standard_namePrimer forward: T-E9-R
noteTTTTTATTCGGTTTTCGCTATCG
targetT-E9
primer_b complement(25..60) standard_nameRT-PCR probe: T-E9-P
noteFAM- TCATTAACTCTTCTCCATCCATTTCCATTTCACAGT-TAMRA
primer_b complement(62..87) standard_namePrimer reverse: T-E9-F
noteTGAGAATGAACAAAAGGACCATATCA
targetT-E9
Sequence information
Length: 87 BP, A Count: 23, C Count: 10, T Count: 34, G Count: 20
tttttattcg gttttcgcta tcgaactgtg aaatggaaat ggatggagaa gagttaatga        60
atgatatggt ccttttgttc attctca                                            87