European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-ELE-00-023;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier
Description
Description Qualitative PCR method for detection of T35S pCAMBIA sequences (Rischitor et al., 2016).
Keywords element_specific.
1 Rischitor P., Lievens A., Mazzara M.; " Element-specific method for t35S-pCAMBIA detection using real-time PCR - Validation Report Qualitative Screening Method" Online Publication (2016)
Reference Position 1-137
2 "PCR reactions set up and amplification conditions" Online Publication (2016)
PCR QL-ELE-00-023.pdf
Reference Position 1-137
Features
Key Location Qualifier Value
STS 1..137 standard_namePCR 137 bp amplicon
noteelement-specific PCR
targetCauliflower Mosaic Virus 35S terminator (CaMV T-35S) in pCAMBIA vector
primer_b 1..21 standard_namePrimer forward: t35S pCAMBIA c-F
noteCGGGGGATCTGGATTTTAGTA
targetT35S pCAMBIA
primer_b complement(115..137) standard_namePrimer reverse: t35S pCAMBIA a-R
noteAGGGTTCCTATAGGGTTTCGCTC
targetT35S pCAMBIA
Sequence information
Length: 137 BP, A Count: 45, C Count: 19, T Count: 46, G Count: 27
cgggggatct ggattttagt actggatttt ggttttagga attagaaatt ttattgatag        60
aagtatttta caaatacaaa tacatactaa gggtttctta tatgctcaac acatgagcga       120
aaccctatag gaaccct                                                      137