European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-ELE-00-013;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier
Description
Description Qualitative duplex PCR method for detection of Cauliflower Mosaic Virus 35S promoter and nopaline synthase terminator (partim T-nos) (Waiblinger et al., 2008).
Keywords element_specific.
1 Waiblinger H.-U., Ernst B., Anderson A., Pietsch K.; "Validation and collaborative study of a P35S and T-nos duplex real-time PCR screening method to detect genetically modified organisms in food products" Eur. Food Res. Technol. 226:1221-1228 (2008)
DOI 10.1007/s00217-007-0748-z
Reference Position 1-84
2 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QL-ELE-00-013.pdf
Reference Position 1-84
Features
Key Location Qualifier Value
STS 1..84 standard_namePCR 84 bp amplicon
noteelement-specific duplex RT-PCR
targetnopaline synthase terminator (T-nos) from Agrobacterium tumefaciens
primer_b 1..25 standard_namePrimer forward: 180-F
noteCATGTAATGCATGACGTTATTTATG
targetT-nos
primer_b 26..59 standard_nameProbe: TM-180YY
noteYY-ATGGGTTTTTATGATTAGAGTCCCGCAA-BHQ1
primer_b complement(60..84) standard_namePrimer reverse: 180-R
noteTTGTTTTCTATCGCGTATTAAATGT
targetT-nos
Sequence information
Length: 84 BP, A Count: 20, C Count: 7, T Count: 15, G Count: 8
catgtaatgc atgacgttat ttatgnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnna        60
catttaatac gcgatagaaa acaa                                               84