ID QL-ELE-00-012; SV 0; linear; genomic DNA; STS; SYN; 82 BP. XX AC ; XX DT 25-MAY-2009 DT 04-OCT-2010 XX DE Qualitative duplex PCR method for detection of Cauliflower Mosaic Virus 35S promoter and nopaline synthase terminator (partim CaMV P-35S) DE (Waiblinger et al., 2008). XX KW element_specific. XX RN [1] RP 1-82 RA Waiblinger H.-U., Ernst B., Anderson A., Pietsch K.; RT "Validation and collaborative study of a P35S and T-nos duplex real-time RT PCR screening method to detect genetically modified organisms in food RT products"; RL Eur. Food Res. Technol. 226:1221-1228 (2008). RX DOI=10.1007/s00217-007-0748-z XX RN [2] RP 1-82 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QL-ELE-00-012.pdf XX DR GMOMETHODS; QL-ELE-00-015; XX FH Key Location/Qualifiers FH FT STS 1..82 FT /standard_name="PCR 82 bp amplicon" FT /note="element-specific duplex RT-PCR" FT /target="Cauliflower Mosaic Virus 35S promoter (CaMV P-35S)" FT primer_bind 1..18 FT /standard_name="Primer forward: 35S-FTM" FT /note="GCCTCTGCCGACAGTGGT" FT /target="CaMV P-35S" FT primer_bind 19..60 FT /standard_name="Probe: 35S-TMP-FAM" FT /note="FAM-CAAAGATGGACCCCCACCCACG-BHQ1" FT primer_bind complement(61..82) FT /standard_name="Primer reverse: 35S-RTM" FT /note="AAGACGTGGTTGGAACGTCTTC" FT /target="CaMV P-35S" XX SQ Sequence 82 BP; 8 A; 13 C; 10 G; 9 T; 42 other; gcctctgccg acagtggtnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 gaagacgttc caaccacgtc tt 82 //