ID QL-ELE-00-006; SV 0; linear; genomic DNA; STS; SYN; 180 BP. XX AC ; XX DT 23-JUN-2009 DT 27-SEP-2010 XX DE Qualitative PCR method for detection of nopaline synthase terminator (T-nos) DE (L 00.00-31, 1998). XX KW element_specific. XX RN [1] RP 1-180 RT "Screening procedure for the detection of genetically modified DNA RT sequences in foods by identification of DNA sequences that frequently RT occur in genetically modified organisms. No. L 00.00-31"; RL Online Publication (1998). XX RN [2] RP 1-180 RA Lipp M., Brodmann P., Pietsch K., Pauwels J., Anklam E., Borchers T., RA Braunschweiger G., Busch U., Eklund E., Eriksen F.D., Fagan J., Fellinger RA A., Gaugitsch H., Hayes D., Hertel C., Hortner H., Joudrier P., Kruse L., RA Meyer R., Miraglia M., Muller W., Phillipp P., Popping B., Rentsch R., RA Wurtz A., et al.; RT "IUPAC collaborative trial study of a method to detect genetically RT modified soy beans and maize in dried powder"; RL J AOAC Int 82:923-928 (1999). RX PUBMED; 10490320. XX RN [3] RP 1-180 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QL-ELE-00-006.pdf XX FH Key Location/Qualifiers FH FT STS 1..180 FT /standard_name="PCR 180 bp amplicon" FT /note="element-specific PCR" FT /target="nopaline synthase terminator (T-nos) from Agrobacterium tumefaciens" FT primer_bind 1..20 FT /standard_name="Primer forward: NOS-1" FT /note="GAATCCTGTTGCCGGTCTTG" FT /target="T-nos" FT primer_bind complement(161..180) FT /standard_name="Primer reverse: NOS-3" FT /note="TTATCCTAGTTTGCGCGCTA" FT /target="T-nos" XX SQ Sequence 180 BP; 10 A; 9 C; 11 G; 10 T; 140 other; gaatcctgtt gccggtcttg nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 120 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn tagcgcgcaa actaggataa 180 //