European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-CON-00-014;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier
Description
Description Qualitative PCR method for detection of the junction between the nos promoter and the neomycin phosphotransferase II gene
Keywords construct_specific.
From Carica papaya (papaya) - event Sunup-Papaya 55-1
References
1 "Horizontal methods for molecular biomarker analysis -- Methods of analysis for the detection of genetically modified organisms and derived products - Part 4: Real-time PCR based screening methods for the detection of the P-nos and P-nos-nptII DNA sequences" ISO/TS 21569-4:2016 (2016)
ISO 69339
Reference Position 1-170
2 "Detection of a DNA sequence junction between the nos-promoter and the nptII-gene for screening of genetically modified organism using real-time PCR" BVL L 00.00-142:2013-01 Food Analysis, Beuth, Berlin Koln (2013)
BVL bvl-l-00-00-142/179718833
Reference Position 1-170
3 "PCR reactions set up and amplification conditions" Online Publication (2017)
PCR QL-CON-00-014.pdf
Reference Position 1-170
Features
Key Location Qualifier Value
STS 1..170 standard_namePCR 144-170 bp amplicon
noteConstruct-specific RT-PCR
targetJunction region between the nopaline synthase promoter (P-nos) from Agrobacterium tumefaciens and the neomycin phosphotransferase II (nptII) gene
misc_fea 1..170 noteThe fragment size generated by the P-nos-nptII PCR depends on the assembly of the two sequence elements and is varying in the different GM plant events
primer_b 1..22 standard_namePrimer reverse: nptII-R
noteGATTGTCTGTTGTGCCCAGTCA
targetnptII gene
primer_b 24..48 standard_nameRT-PCR probe: nptII-Tm2
noteFAM-AGCCGAATAGCCTCTCCACCCAAGC-BBQ
primer_b complement(148..170) standard_namePrimer forward: pnos-F2
noteTTCCCCTCGGTATCCAATTAGAG
targetP-nos
Sequence information
Length: 170 BP, A Count: 47, C Count: 34, T Count: 39, G Count: 50
gattgtctgt tgtgcccagt catagccgaa tagcctctcc acccaagcgg ccggagaacc        60
tgcccggatc cgggcggaaa taggtaaaga agttgcggat aaggtaattg ccattgcaga       120
ttatttggat tgagagtgaa tatgagactc taattggata ccgaggggaa                  170