European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-CON-00-013;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier
Description
Description Qualitative PCR method for detection of the junction between the maize ubiquitin promoter and the modified cry1Ab/1Ac genes (Grohmann et al.,2015).
Keywords construct_specific.
From Oryza sativa (rice) - KeFeng6
References
1 Grohmann L., Reiting R., Maede D., Uhlig S., Simon K., Frost K., Jit Randhawa G., Zur K.; "Collaborative trial validation of cry1Ab/Ac and Pubi-cry TaqMan-based real-time PCR assays for detection of DNA derived from genetically modified Bt plant products" Accred Qual Assur 20:85-96 (2015)
DOI 10.1007/s00769-015-1108-5
Reference Position 1-90
3 "Detection of genetically modified cry1Ab/Ac and P-ubi-cry DNA sequences in rice products using real-time PCR" BVL L 15.06-3:2013-08 (2013)
BVL bvl-l-1506-3/193413251
Reference Position 1-90
3 "PCR reactions set up and amplification conditions" Online Publication (2015)
PCR QL-CON-00-013.pdf
Reference Position 1-90
Cross-references
GMOMETHODS QL-TAX-OS-003;
Features
Key Location Qualifier Value
STS 1..90 standard_namePCR 90 bp amplicon
noteConstruct-specific RT-PCR
targetJunction region between the maize ubiquitin promoter (P-ubi) and the modified cry1Ab/1Ac genes
primer_b 1..26 standard_namePrimer forward: Pubi-F2
noteATTTGCTTGGTACTGTTTCTTTTGTC
targetP-ubi
primer_b 34..60 standard_nameRT-PCR probe: Pubi-T2
noteFAM-ACCCTGTTGTTTGGTGTTACTTCTGCA-NFQ
primer_b complement(66..90) standard_namePrimer reverse: Cry-rr-R
noteTTGTTGTCCATGGATCCTCTAGAGT
targetcry1Ab/Ac
Sequence information
Length: 90 BP, A Count: 16, C Count: 19, T Count: 34, G Count: 21
atttgcttgg tactgtttct tttgtcnnnn nnnaccctgt tgtttggtgt tacttctgca        60
nnnnnactct agaggatcca tggacaacaa                                         90