ID QL-CON-00-011; SV 1; linear; genomic DNA; STD; SYN; 102 BP. XX AC ; XX DT 20-DEC-2013 DT 29-FEB-2016 XX DE Qualitative PCR method for detection of the junction between the Cauliflower Mosaic Virus 35S promoter and the pat gene XX KW construct_specific. XX RN [1] RP 1-102 RT "Horizontal methods for molecular biomarker analysis -- Methods of analysis for the detection of genetically modified organisms and derived products - Part 3: Construct-specific real-time PCR method for detection of P35S-pat-sequence for screening genetically modified organisms"; RL ISO/TS 21569-3:2015 (2015). RX ISO=63468 XX RN [2] RP 1-102 RT "Real-time PCR detection of the P35S-pat genetic construct to screen for genetically modified plants"; RL BVL G 30.40-1:2012-07 (2012). RX BVL=bvl-g-3040-1/155757481 XX RN [3] RP 1-102 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2014). RX PCR=QL-CON-00-011.pdf XX FH Key Location/Qualifiers FH FT STS 1..102 FT /standard_name="PCR 102-111 bp amplicon" FT /note="construct-specific RT-PCR" FT /target="Junction region between the Cauliflower Mosaic Virus 35S promoter (CaMV P-35S) and the phosphinothricin N-acetyl transferase (pat) gene from Streptomyces viridochromogenes" FT primer_bind 1..25 FT /standard_name="Primer forward: 35SP03.f" FT /note="AAGTTCATTTCATTTGGAGAGGACA" FT /target="CaMV P-35S" FT primer_bind 51..78 FT /standard_name="RT-PCR probe: probe GSS01.s" FT /note="FAM-CCGGAGAGGAGACCAGTTGAGATTAGGC-TAMRA" FT primer_bind complement(82..102) FT /standard_name="Primer reverse: pat-7.r" FT /note="CGGCCATATCAGCTGCTGTAG" FT /target="pat" XX SQ Sequence 102 BP; 26 A; 23 C; 32 G; 21 T; 0 other; aagttcattt catttggaga ggacannnnn nnnnnnnnnn nnnnnnnnnn ccggagagga 60 gaccagttga gattaggcnn nctacagcag ctgatatggc cg 102 //