European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-CON-00-008;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier
Description
Description Qualitative PCR method for detection of the junction between the chloroplast transit peptide 2 and the CP4 epsps gene (Grohmann et al., 2009).
Keywords construct_specific.
1 Grohmann L., Brunen-Nieweler C., Nemeth A., Waiblinger H.U.; "Collaborative trial validation studies of real-time PCR-based GMO screening methods for detection of the bar gene and the ctp2-cp4epsps construct" J. Agric. Food Chem. 57:8913-8920 (2009)
PUBMED 19807158
DOI 10.1021/jf901598r
Reference Position 1-88
2 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QL-CON-00-008.pdf
Reference Position 1-88
Features
Key Location Qualifier Value
STS 1..88 standard_namePCR 88 bp amplicon
noteconstruct-specific RT-PCR
targetJunction region between the chloroplast transit peptide 2 (CTP2) sequence from the Arabidopsis thaliana epsps gene and the CP4 epsps gene from Agrobacterium tumefasciens (CP4 EPSPS)
primer_b 1..22 standard_namePrimer forward: GT73-TmF
noteGGGATGACGTTAATTGGCTCTG
targetCTP2
primer_b 23..69 standard_nameRT-PCR probe: GT73-TmP
noteFAM-CACGCCGTGGAAACAGAAGACATGACC-TAMRA
primer_b complement(70..88) standard_namePrimer reverse: GT73-TmR
noteGGCTGCTTGCACCGTGAAG
targetCP4-EPSPS
Sequence information
Length: 88 BP, A Count: 8, C Count: 10, T Count: 10, G Count: 13
gggatgacgt taattggctc tgnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
nnnnnnnnnc ttcacggtgc aagcagcc                                           88