European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-ZM-022;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier SYN-IR162-4
Description
Description Quantitative PCR method for detection of maize event MIR162 (Charles Delobel et al., 2011)
Keywords event_specific.
From Zea mays (maize) - event MIR162 (SYN-IR162-4)
References
1 Charles Delobel C., Mazzara M., Bevilacqua A., Van den Eede G.; "Event-specific Method for the Quantification of Maize MIR162 by Real-time PCR - Validation Report and Protocol" Online Publication (2011)
DOI 10.2788/44161
Reference Position 1-92
2 "PCR reactions set up and amplification conditions" Online Publication (2011)
PCR QT-EVE-ZM-022.pdf
Reference Position 1-92
Cross-references
GMOMETHODS QT-TAX-ZM-014;
Features
Key Location Qualifier Value
STS 1..92 standard_namePCR 92 bp amplicon
noteevent-specific RT-PCR
target3' integration border region (IBR) between the insert of maize event MIR162 and the maize host genome
primer_b 1..24 standard_namePrimer forward: MIR162-f1
noteGCGCGGTGTCATCTATGTTACTAG
targetinsert
primer_b 34..67 standard_nameRT-PCR probe: MIR162-p1
noteFAM-TCTAGACAATTCAGTACATTAAAAACGTCCGCCA- TAMRA
primer_b complement(71..92) standard_namePrimer reverse: MIR162-r1
noteTGCCTTATCTGTTGCCTTCAGA
target3'-host genome
Sequence information
Length: 92 BP, A Count: 27, C Count: 22, T Count: 21, G Count: 22
gcgcggtgtc atctatgtta ctagnnnnnn nnntctagac aattcagtac attaaaaacg        60
tccgccannn tctgaaggca acagataagg ca                                      92