European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-ZM-021;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier DP-098140-6
Description
Description Quantitative PCR method for detection of maize event 98140 (Savini et al., 2011)
Keywords event_specific.
From Zea mays (maize) - event 98140 (DP-098140-6)
References
1 Savini C., ; "Event-specific Method for the Quantification of Maize 98140 Using Real-time PCR - Validation Report and Protocol" Online Publication (2011)
EURL_GMFF DP-098140-6_validated_Method.pdf
EURL_GMFF DP-098140-6_val_report.pdf
Reference Position 1-80
2 "PCR reactions set up and amplification conditions" Online Publication (2011)
PCR QT-EVE-ZM-021.pdf
Reference Position 1-80
Cross-references
GMOMETHODS QT-TAX-ZM-002;
Features
Key Location Qualifier Value
STS 1..80 standard_namePCR 80 bp amplicon
noteevent-specific RT-PCR
target5'integration border region (IBR) between the insert of maize event 98140 and the maize host genome
primer_b 1..26 standard_namePrimer forward: DP098-f6
noteGTGTGTATGTCTCTTTGCTTGGTCTT
target5'-host genome
primer_b 28..60 standard_nameRT-PCR probe: DP098-p5
noteFAM-CTCTATCGATCCCCCTCTTTGATAGTTTAAACT-TAMRA
primer_b complement(61..80) standard_namePrimer reverse: DP098-r2
noteGATTGTCGTTTCCCGCCTTC
targetinsert
Sequence information
Length: 80 BP, A Count: 16, C Count: 18, T Count: 29, G Count: 17
gtgtgtatgt ctctttgctt ggtcttnctc tatcgatccc cctctttgat agtttaaact        60
gaaggcggga aacgacaatc                                                    80