European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-ZM-020;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier MON-00810-6
Description
Description Quantitative PCR method for detection of maize event MON810.
Keywords event_specific.
From Zea mays (maize) - event MON810 (MON-00810-6)
References
1 "Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - Quantitative nucleic acid based methods" ISO 21570:1-103 (2005)
ISO 34615
Reference Position 1-92
2 Mazzara M., Grazioli E., Savini C., Van Den Eede G.; "Report on the Verification of the Performance of a MON810 Event-specific Method on Maize Line MON810 Using Real-time PCR - Validation Report and Protocol" Online Publication (2009)
DOI 10.2788/59036
Reference Position 1-92
3 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QT-EVE-ZM-020.pdf
Reference Position 1-92
Cross-references
GMOMETHODS QT-TAX-ZM-002;
Features
Key Location Qualifier Value
STS 1..92 standard_namePCR 92 bp amplicon
noteevent-specific RT-PCR
target5' integration border region (IBR) between the insert of maize event MON 810 and the maize host genome
primer_b 1..24 standard_namePrimer forward: Mail-F1
noteTCGAAGGACGAAGGACTCTAACGT
target5'-host genome
primer_b 25..68 standard_nameRT-PCR probe: mail-S2
noteFAM-AACATCCTTTGCCATTGCCCAGC-TAMRA
primer_b complement(69..92) standard_namePrimer reverse: Mail-R1
noteGCCACCTTCCTTTTCCACTATCTT
targetinsert
Sequence information
Length: 92 BP, A Count: 18, C Count: 6, T Count: 7, G Count: 17
tcgaaggacg aaggactcta acgtnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
nnnnnnnnaa gatagtggaa aaggaaggtg gc                                      92