European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-ZM-015;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier SYN-BT011-1
Description
Description Quantitative PCR method for detection of maize event Bt11 (Charles Delobel et al., 2008).
Keywords event_specific.
From Zea mays (maize) - event Bt11 (SYN-BT011-1)
References
1 Charles Delobel C., Larcher S., Mazzara M., Van Den Eede G.; "Event-specific Method for the Quantification of Maize Event Bt11 Using Real-time PCR - Validation Report and Protocol" Online Publication (2008)
DOI 10.2788/4370
Reference Position 1-68
2 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QT-EVE-ZM-015.pdf
Reference Position 1-68
Cross-references
GMOMETHODS QT-TAX-ZM-014;
Features
Key Location Qualifier Value
STS 1..68 standard_namePCR 68 bp amplicon
noteevent-specific RT-PCR
target5' integration border region (IBR) between the insert of maize event Bt11 and the maize host genome
primer_b 1..21 standard_namePrimer forward: Bt11-ev-f1
noteTGTGTGGCCATTTATCATCGA
target5'-host genome
primer_b 23..51 standard_nameRT-PCR probe: Bt11-ev-p1
noteFAM-TTCCATGACCAAAATCCCTTAACGTGAGT-TAMRA
primer_b complement(48..68) standard_namePrimer reverse: Bt11-ev-r5
noteCGCTCAGTGGAACGAAAACTC
targetinsert
Sequence information
Length: 68 BP, A Count: 15, C Count: 17, T Count: 22, G Count: 13
tgtgtggcca tttatcatcg anttccatga ccaaaatccc ttaacgtgag ttttcgttcc        60
actgagcg                                                                 68