European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-ZM-014;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier MON-00021-9
Description
Description Quantitative PCR method for detection of maize event GA21 (Charles Delobel et al., 2007).
Keywords event_specific.
From Zea mays (maize) - event GA21 (MON-00021-9)
References
1 Charles Delobel C., Larcher S., Savini C., Mazzara M., Van Den Eede G.; "Event-specific Method for the Quantification of Maize Line GA21 Using Real-time PCR - Validation Report and Protocol - Report on the Verification of Performance of a DNA Extraction Method for Maize Grains" Online Publication (2007)
DOI 10.2788/62889
Reference Position 1-101
2 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QT-EVE-ZM-014.pdf
Reference Position 1-101
Cross-references
GMOMETHODS QT-TAX-ZM-014;
Features
Key Location Qualifier Value
STS 1..101 standard_namePCR 101 bp amplicon
noteevent-specific RT-PCR
target5' integration border region (IBR) between the insert of maize event GA21 and the maize host genome
primer_b 1..27 standard_namePrimer forward: esGA21-5' forward primer
noteCGTTATGCTATTTGCAACTTTAGAACA
target5'-host genome
primer_b 46..71 standard_nameRT-PCR probe: esGA21-5' probe
noteFAM-TTTCTCAACAGCAGGTGGGTCCGGGT-TAMRA
primer_b complement(85..101) standard_namePrimer reverse: esGA21-5' reverse primer
noteGCGATCCTCCTCGCGTT
targetinsert
Sequence information
Length: 101 BP, A Count: 17, C Count: 15, T Count: 18, G Count: 20
cgttatgcta tttgcaactt tagaacannn nnnnnnnnnn nnnnntttct caacagcagg        60
tgggtccggg tnnnnnnnnn nnnnaacgcg aggaggatcg c                           101