European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-ZM-011;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier ACS-ZM003-2
Description
Description Quantitative PCR method for detection of maize event T25 (Mazzara et al., 2013).
Keywords event_specific.
From Zea mays (maize) - Event T25 (ACS-ZM003-2)
References
1 Mazzara M., Grazioli E., Savini C., Van Den Eede G.; "Event-specific Method for the Quantification of Maize Line T25 Using Real-time PCR v. 1.01 - Validation Report and Validated Method" Online Publication (2013)
DOI 10.2788/18420
Reference Position 1-102
2 "PCR reactions set up and amplification conditions" Online Publication (2013)
PCR QT-EVE-ZM-011.pdf
Reference Position 1-102
Cross-references
GMOMETHODS QT-TAX-ZM-003;
Features
Key Location Qualifier Value
STS 1..102 standard_namePCR 102 bp amplicon
noteevent-specific RT-PCR
target3' integration border region (IBR) between the insert of maize event T25 and the maize host genome
primer_b 1..20 standard_namePrimer forward: MLD143
noteACAAGCGTGTCGTGCTCCAC
targetinsert
primer_b 46..70 standard_nameRT-PCR probe: TM016
noteFAM-TCATTGAGTCGTTCCGCCATTGTCG-TAMRA
primer_b complement(82..102) standard_namePrimer reverse: MDB551
noteGACATGATACTCCTTCCACCG
target3'-host genome
Sequence information
Length: 102 BP, A Count: 12, C Count: 17, T Count: 18, G Count: 19
acaagcgtgt cgtgctccac nnnnnnnnnn nnnnnnnnnn nnnnntcatt gagtcgttcc        60
gccattgtcg nnnnnnnnnn ncggtggaag gagtatcatg tc                          102