European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-ZM-007;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier MON-00021-9
Description
Description Quantitative PCR method for detection of maize event GA21 (Paoletti et al., 2005).
Keywords event_specific.
From Zea mays (maize) - event GA21 (MON-00021-9)
References
1 Paoletti C., Mazzara M., Puumalaainen J., Rasulo D., Van Den Eede G.; "Validation of an Event-Specific Method for the Quantitation of Maize Line GA21 Using Real-Time PCR Validation Report and Protocol" Online Publication (2005)
CRL GA21_Validation_Report+Protocol[1].pdf
Reference Position 1-112
2 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QT-EVE-ZM-007.pdf
Reference Position 1-112
Cross-references
GMOMETHODS QT-TAX-ZM-011;
Features
Key Location Qualifier Value
STS 1..112 standard_namePCR 112 bp amplicon (Monsanto)
noteevent-specific RT-PCR
target5' integration border region (IBR) between the insert of maize event GA21 and the maize host genome
primer_b 1..29 standard_namePrimer forward: GA21 primer F
noteCTTATCGTTATGCTATTTGCAACTTTAGA
target5'-host genome
primer_b 31..70 standard_nameRT-PCR probe: GA21 Probe PR
noteFAM-CATATACTAACTCATATCTCTTTCTCAACAGCAGGTGGGT- TAMRA
primer_b complement(96..112) standard_namePrimer reverse: GA21 primer R
noteTGGCTCGCGATCCTCCT
targetinsert
Sequence information
Length: 112 BP, A Count: 23, C Count: 19, T Count: 27, G Count: 17
cttatcgtta tgctatttgc aactttagan catatactaa ctcatatctc tttctcaaca        60
gcaggtgggt nnnnnnnnnn nnnnnnnnnn nnnnnaggag gatcgcgagc ca               112