Entry information |
Entry name | QT-EVE-ZM-007; See in JRC GMO-Matrix See in JRC GMO-Amplicons |
GMO Unique Identifier | MON-00021-9 |
Description |
Description | Quantitative PCR method for detection of maize event GA21 (Paoletti et al., 2005). |
Keywords | event_specific. |
From | Zea mays (maize) - event GA21 (MON-00021-9) |
References |
1 | Paoletti C., Mazzara M., Puumalaainen J., Rasulo D., Van Den Eede G.; "Validation of an Event-Specific Method for the Quantitation of Maize Line GA21 Using Real-Time PCR Validation Report and Protocol" Online Publication (2005) |
2 | "PCR reactions set up and amplification conditions" Online Publication (2010) |
Cross-references |
GMOMETHODS | QT-TAX-ZM-011; |
Features |
Key | Location | Qualifier | Value | STS | 1..112 | standard_name | PCR 112 bp amplicon (Monsanto) | note | event-specific RT-PCR | target | 5' integration border region (IBR) between the insert of maize event GA21 and the maize host genome | primer_b | 1..29 | standard_name | Primer forward: GA21 primer F | note | CTTATCGTTATGCTATTTGCAACTTTAGA | target | 5'-host genome | primer_b | 31..70 | standard_name | RT-PCR probe: GA21 Probe PR | note | FAM-CATATACTAACTCATATCTCTTTCTCAACAGCAGGTGGGT- TAMRA | primer_b | complement(96..112) | standard_name | Primer reverse: GA21 primer R | note | TGGCTCGCGATCCTCCT | target | insert |
|
Sequence information |
Length: 112 BP, A Count: 23, C Count: 19, T Count: 27, G Count: 17 |
cttatcgtta tgctatttgc aactttagan catatactaa ctcatatctc tttctcaaca 60
gcaggtgggt nnnnnnnnnn nnnnnnnnnn nnnnnaggag gatcgcgagc ca 112
|