European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-ZM-006;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier SYN-BT011-1
Description
Description Quantitative PCR method for detection of maize event Bt11 (Mazzara et al., 2005).
Keywords event_specific.
From Zea mays (maize) - event Bt11 (SYN-BT011-1)
References
1 Mazzara M., Puumalaainen J., Van Den Eede G.; "Validation of the GMO Specific Detection Method Developed by NVI/INRA for Bt11 in Sweet Corn Maize - Validation Report and Protocol" Online Publication (2005)
BSHOP LBNA21829
Reference Position 1-70
2 "Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - Quantitative nucleic acid based methods" ISO 21570:1-103 (2005)
ISO 34615
Reference Position 1-70
3 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QT-EVE-ZM-006.pdf
Reference Position 1-70
Cross-references
GMOMETHODS QT-TAX-ZM-001;
Features
Key Location Qualifier Value
STS 1..70 standard_nameevent-specific PCR amplicon
noteevent-specific RT-PCR
target3' integration border region (IBR) between the insert of maize event Bt11 and the maize host genome
primer_b 1..20 standard_namePrimer forward: Bt113JFor
noteGCGGAACCCCTATTTGTTTA
targetinsert
primer_b 28..54 standard_nameRT-PCR probe: Bt113JFT
noteFAM-AAATACATTCAAATATGTATCCGCTCA-TAMRA
primer_b complement(51..70) standard_namePrimer reverse: Bt113JRev
noteTCCAAGAATCCCTCCATGAG
target3' junction
Sequence information
Length: 70 BP, A Count: 18, C Count: 12, T Count: 20, G Count: 13
gcggaacccc tatttgttta nnnnnnnaaa tacattcaaa tatgtatccg ctcatggagg        60
gattcttgga                                                               70