European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-ZM-005;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier MON-87460-4
Description
Description Quantitative PCR method for detection of maize event MON87460 (Savini et al., 2011)
Keywords event_specific.
From Zea mays (maize) - event MON87460 (MON-87460-4)
References
1 Savini C., Mazzara M., Pinski G., Van den Eede G.; "Event-specific Method for the Quantification of Maize MON87460 Using Real-time PCR -Validation Report and Validated Method" Online Publication (2012)
DOI 10.2788/45380
Reference Position 1-82
2 "PCR reactions set up and amplification conditions" Online Publication (2012)
PCR QT-EVE-ZM-005.pdf
Reference Position 1-82
Cross-references
GMOMETHODS QT-TAX-ZM-002;
Features
Key Location Qualifier Value
STS 1..82 standard_namePCR 82 bp amplicon
noteevent-specific RT-PCR
target5'integration border region (IBR) between the insert of maize event MON87460 and the maize host genome
primer_b 1..22 standard_namePrimer forward: MON 87460 primer 1
noteCACGTTGAAGGAAAATGGATTG
target5'-host genome
primer_b 24..61 standard_nameRT-PCR probe: MON 87460 Probe
noteFAM- AGGGAGTATGTAGATAAATTTTCAAAGCGTTAGACGGC-TAMRA
primer_b complement(63..82) standard_namePrimer reverse: MON 87460 Primer 2
noteTCGCGATCCTCCTCAAAGAC
targetinsert
Sequence information
Length: 82 BP, A Count: 25, C Count: 9, T Count: 21, G Count: 27
cacgttgaag gaaaatggat tgnagggagt atgtagataa attttcaaag cgttagacgg        60
cngtctttga ggaggatcgc ga                                                 82