European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-GM-011;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier BPS-CV127-9
Description
Description Quantitative PCR method for detection of soybean event CV127 (Savini et al., 2011)
Keywords event_specific.
From Glycine max (soybean) - event CV127 (BPS-CV127-9)
References
1 Savini C., Mazzara M., Pinski G., Van den Eede G.; "Event-specific Method for the Quantification of Soybean CV127 Using Real-time PCR - Validation Report and Protocol" Online Publication (2011)
DOI 10.2788/37626
Reference Position 1-88
2 "PCR reactions set up and amplification conditions" Online Publication (2011)
PCR QT-EVE-GM-011.pdf
Reference Position 1-88
Cross-references
GMOMETHODS QT-TAX-GM-002;
Features
Key Location Qualifier Value
STS 1..88 standard_namePCR 88 bp amplicon
noteEvent-specific RT-PCR
target3' integration border region (IBR) between the insert of soybean event CV127 and the soybean host genome
primer_b 1..28 standard_namePrimer forward: SE-127-f4
noteAACAGAAGTTTCCGTTGAGCTTTAAGAC
targetinsert
primer_b 30..52 standard_nameRT-PCR probe: SE-127-p3
note6-FAM-TTTGGGGAAGCTGTCCCATGCCC-TAMRA
primer_b complement(66..88) standard_namePrimer reverse: SE-127-r2
noteCATTCGTAGCTCGGATCGTGTAC
target3'-host genome
Sequence information
Length: 88 BP, A Count: 27, C Count: 20, T Count: 19, G Count: 22
aacagaagtt tccgttgagc tttaagacnt ttggggaagc tgtcccatgc ccnnnnnnnn        60
nnnnngtaca cgatccgagc tacgaatg                                           88