European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-GM-009;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier DP-356043-5
Description
Description Quantitative PCR method for detection of soybean event DP-356043-5 (Mazzara et al., 2013).
Keywords event_specific.
From Glycine max (soybean) - event DP-356043-5 (DP-356043-5)
References
1 Mazzara M., Munaro B., Grazioli E., Savini C., Charles Delobel C., Van Den Eede G.; "Event-specific Method for the Quantification of Soybean Event DP-356043-5 Using Real-time PCR v.1.01 - Validation Report and Validated Method" Online Publication (2013)
DOI 10.2788/16469
Reference Position 1-99
2 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QT-EVE-GM-009.pdf
Reference Position 1-99
Cross-references
GMOMETHODS QT-TAX-GM-002;
Features
Key Location Qualifier Value
STS 1..99 standard_namePCR 99 bp amplicon
noteevent-specific RT-PCR
target5' integration border region (IBR) between the insert of soybean event DP-356043-5 and the soybean host genome
primer_b 1..26 standard_namePrimer forward: DP356-f1
noteGTCGAATAGGCTAGGTTTACGAAAAA
target5'-host genome
primer_b 40..69 standard_nameRT-PCR probe: DP356-p
noteFAM-CTCTAGAGATCCGTCAACATGGTGGAGCAC-TAMRA
primer_b complement(71..99) standard_namePrimer reverse: DP356-r1
noteTTTGATATTCTTGGAGTAGACGAGAGTGT
targetinsert
Sequence information
Length: 99 BP, A Count: 29, C Count: 20, T Count: 19, G Count: 17
gtcgaatagg ctaggtttac gaaaaannnn nnnnnnnnnc tctagagatc cgtcaacatg        60
gtggagcacn acactctcgt ctactccaag aatatcaaa                               99