European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-GM-008;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier DP-305423-1
Description
Description Quantitative PCR method for detection of soybean event DP-305423-1 (Mazzara et al., 2013).
Keywords event_specific.
From Glycine max (soybean) - event DP-305423-1 (DP-305423-1)
References
1 Mazzara M., Munaro B., Grazioli E., Savini C., Charles Delobel C., Van Den Eede G.; "Event-specific Method for the Quantification of Soybean Event DP-305423-1 Using Real-time PCR v. 1.01 - Validation Report and Validated Method" Online Publication (2013)
DOI 10.2788/21515
Reference Position 1-93
2 "PCR reactions set up and amplification conditions" Online Publication (2013)
PCR QT-EVE-GM-008.pdf
Reference Position 1-93
Cross-references
GMOMETHODS QT-TAX-GM-002;
Features
Key Location Qualifier Value
STS 1..93 standard_namePCR 93 bp amplicon
noteevent-specific RT-PCR
target3' integration border region (IBR) between the insert of soybean event DP-305423-1 and the soybean host genome
primer_b 1..21 standard_namePrimer forward: DP305-f1
noteCGTGTTCTCTTTTTGGCTAGC
targetinsert
primer_b complement(33..64) standard_nameRT-PCR probe: DP305-p
noteFAM-TGACACAAATGATTTTCATACAAAAGTCGAGA-TAMRA
primer_b complement(66..93) standard_namePrimer reverse: DP305-r5
noteGTGACCAATGAATACATAACACAAACTA
target3'-host genome
Sequence information
Length: 93 BP, A Count: 14, C Count: 13, T Count: 38, G Count: 16
cgtgttctct ttttggctag cnnnnnnnnn nntctcgact tttgtatgaa aatcatttgt        60
gtcantagtt tgtgttatgt attcattggt cac                                     93