European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-GM-005;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier MON-04032-6
Description
Description Quantitative PCR method for detection of soybean event GTS-40-3-2 (Mazzara et al., 2007).
Keywords event_specific.
From Glycine max (soybean) - event GTS-40-3-2 (MON-04032-6)
References
1 Mazzara M., Munaro B., Larcher S., Grazioli E., Charles Delobel C., Savini C., Van Den Eede G.; "Event-specific Method for the Quantification of Soybean Line 40-3-2 Using Real-time PCR - Validation Report and Protocol - Report on the Validation of a DNA Extraction Method for Soybean Seeds. Online Publication (2007)
DOI 10.2788/61824
Reference Position 1-84
2 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QT-EVE-GM-005.pdf
Reference Position 1-84
Cross-references
GMOMETHODS QT-TAX-GM-002;
Features
Key Location Qualifier Value
STS 1..84 standard_namePCR 84 bp amplicon
noteevent-specific RT-PCR
target5' integration border region (IBR) between the insert of soybean event GTS 40-3-2 and the soybean host genome
primer_b 1..31 standard_namePrimer forward: 40-3-2 AF
noteTTCATTCAAAATAAGATCATACATACAGGTT
target5'-host genome
primer_b complement(49..63) standard_nameRT-PCR probe: 40-3-2 AP
noteFAM-CCTTTTCCATTTGGG-MGBNFQ
primer_b complement(64..84) standard_namePrimer reverse: 40-3-2 AR
noteGGCATTTGTAGGAGCCACCTT
targetinsert
Sequence information
Length: 84 BP, A Count: 26, C Count: 14, T Count: 15, G Count: 12
ttcattcaaa ataagatcat acatacaggt tnnnnnnnnn nnnnnnnncc caaatggaaa        60
aggaaggtgg ctcctacaaa tgcc                                               84