European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-GM-004;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier ACS-GM005-3
Description
Description Quantitative PCR method for detection of soybean event A2704-12 (Mazzara et al., 2007).
Keywords event_specific.
From Glycine max (soybean) - event A2704-12 (ACS-GM005-3)
References
1 Mazzara M., Charles Delobel C., Grazioli E., Larcher S., Savini C., Van Den Eede G.; "Event-Specific Method for the Quantification of Soybean Line A2704-12 Using Real-Time PCR- Validation Report and Protocol - Soybean Seeds Sampling and DNA Extraction" Online Publication (2007)
DOI 10.2788/28149
Reference Position 1-64
2 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QT-EVE-GM-004.pdf
Reference Position 1-64
Cross-references
GMOMETHODS QT-TAX-GM-009;
Features
Key Location Qualifier Value
STS 1..64 standard_namePCR 64 bp amplicon
noteevent-specific RT-PCR
targetJunction region containing a 3' bla sequence and an inverted 5' bla sequence
primer_b 1..21 standard_namePrimer forward: KVM175
noteGCAAAAAAGCGGTTAGCTCCT
targetbla
primer_b 23..43 standard_nameRT-PCR probe: TM031
noteFAM-CGGTCCTCCGATCGCCCTTCC-TAMRA
primer_b complement(45..64) standard_namePrimer reverse: SMO001
noteATTCAGGCTGCGCAACTGTT
targetpUC19
Sequence information
Length: 64 BP, A Count: 14, C Count: 21, T Count: 13, G Count: 14
gcaaaaaagc ggttagctcc tncggtcctc cgatcgccct tccnaacagt tgcgcagcct        60
gaat                                                                     64