European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-GM-003;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier MON-87705-6
Description
Description Quantitative PCR method for detection of soybean event MON87705 (Savini et al., 2012)
Keywords event_specific.
From Glycine max (soybean) - event MON87705 (MON-87705-6)
References
1 Savini C., Mazzara M., Charles Delobel C., Pinski G., Van den Eede G.; "Event-specific Method for the Quantification of Soybean MON87705 Using Real-time PCR - Validation Report and Validated Method" Online Publication (2012)
DOI 10.2788/48383
Reference Position 1-86
2 "PCR reactions set up and amplification conditions" Online Publication (2012)
PCR QT-EVE-GM-003.pdf
Reference Position 1-86
Cross-references
GMOMETHODS QT-TAX-GM-002;
Features
Key Location Qualifier Value
STS 1..86 standard_namePCR 86 bp amplicon
noteEvent-specific RT-PCR
target3'integration border region (IBR) between the insert of soybean event MON87705 and the soybean host genome
primer_b 1..23 standard_namePrimer forward: MON 87705 primer 1
noteTTCCCGGACATGAAGCCATTTAC
targetinsert
primer_b 29..58 standard_nameRT-PCR probe: MON 87705 probe
noteFAM-AAGAGACTCAGGGTGTTGTTATCACTGCGG- TAMRA
primer_b complement(65..86) standard_namePrimer reverse: MON 87705 primer 2
noteACAACGGTGCCTTGGCCCAAAG
target3'-host genome
Sequence information
Length: 86 BP, A Count: 18, C Count: 19, T Count: 25, G Count: 24
ttcccggaca tgaagccatt tacnnnnnaa gagactcagg gtgttgttat cactgcggnn        60
nnnnctttgg gccaaggcac cgttgt                                             86