European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-BN-008;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier ACS-BN007-1
Description
Description Quantitative PCR method for detection of oilseed rape event Topas 19/2 (verified by the EU-RL GMFF in the context of Commission Decision 2007/307/EC)
Keywords event_specific, EU-RL_GMFF_in-house_verified.
From Brassica napus (oilseed rape) - event Topas 19/2 (ACS-BN007-1)
References
1 Mazzara M.,; "In-house Validation of an Event-specific Method for the Quantification of Oilseed Rape Topas 19/2 Using Real-time PCR - Validation Report and Protocol" Online Publication (2011)
EURL_GMFF CRLVL1204 VR.pdf
EURL_GMFF CRLVL1204 VP.pdf
Reference Position 1-95
2 "PCR reactions set up and amplification conditions" Online Publication (2011)
PCR QT-EVE-BN-008.pdf
Reference Position 1-95
Cross-references
GMOMETHODS QT-TAX-BN-012;
Features
Key Location Qualifier Value
STS 1..95 standard_namePCR 95 bp amplicon
noteevent-specific RT-PCR
target3'integration border region (IBR) between the insert of oilseed rape event Topas 19/2 and the oilseed rape host genome
primer_b 1..20 standard_namePrimer forward: MDB685
noteGTTGCGGTTCTGTCAGTTCC
targetinsert
primer_b 38..54 standard_nameRT-PCR probe: TM029
noteFAM-TCCCGCGTCATCGGCGG-TAMRA
primer_b complement(76..95) standard_namePrimer reverse: KVM180
noteCGACCGGCGCTGATATATGA
target3'-host genome
Sequence information
Length: 95 BP, A Count: 16, C Count: 27, T Count: 23, G Count: 29
gttgcggttc tgtcagttcc nnnnnnnnnn nnnnnnntcc cgcgtcatcg gcggnnnnnn        60
nnnnnnnnnn nnnnntcata tatcagcgcc ggtcg                                   95