European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-BN-007;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier ACS-BN002-5
Description
Description Quantitative PCR method for detection of oilseed rape event Rf2 (verified by the EU-RL GMFF in the context of Commission Decision 2007/306/EC)
Keywords event_specific, EU-RL_GMFF_in-house_verified.
From Brassica napus (oilseed rape) - event RF2 (ACS-BN002-5)
References
1 Mazzara M.,; "In-house Validation of an Event-specific Method for the Quantification of Oilseed Rape RF2 Using Real-time PCR - Validation Report and Protocol" Online Publication (2011)
EURL_GMFF Rf2 Validation Report.pdf
EURL_GMFF Rf2 Validated Method Protocol CRL-VL-1004.pdf
Reference Position 1-104
2 "PCR reactions set up and amplification conditions" Online Publication (2011)
PCR QT-EVE-BN-007.pdf
Reference Position 1-104
Cross-references
GMOMETHODS QT-TAX-BN-012;
Features
Key Location Qualifier Value
STS 1..104 standard_namePCR 104 bp amplicon
noteevent-specific RT-PCR
target5'integration border region (IBR) between the insert of oilseed rape event RF2 and the oilseed rape host genome
primer_b 1..21 standard_namePrimer forward: MDB207
noteGGGTGAGACAATATATCGACG
target5'-host genome
primer_b 52..77 standard_nameRT-PCR probe: TM024
noteFAM-CACCGGCCAAATTCGCTCTTAGCCGT-TAMRA
primer_b complement(87..104) standard_namePrimer reverse: KVM171
noteGGGCATCGCACCGGTGAG
targetinsert
Sequence information
Length: 104 BP, A Count: 29, C Count: 27, T Count: 27, G Count: 21
gggtgagaca atatatcgac gnnnnnnnnn nnnnnnnnnn nnnnnnnnnn ncaccggcca        60
aattcgctct tagccgtnnn nnnnnnctca ccggtgcgat gccc                        104