European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-BN-006;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier ACS-BN001-4
Description
Description Quantitative PCR method for detection of oilseed rape event RF1 (verified by the EU-RL GMFF in the context of Commission Decision 2007/305/EC)
Keywords event_specific, EU-RL_GMFF_in-house_verified.
From Brassica napus (oilseed rape) - event RF1 (ACS-BN001-4)
References
1 Mazzara M.,; "In-house Validation of an Event-specific Method for the Quantification of Oilseed Rape RF1 Using Real-time PCR - Validation Report and Protocol" Online Publication (2011)
EURL_GMFF CRLVL0904 VR.pdf
EURL_GMFF CRLVL0904 VP.pdf
Reference Position 1-113
2 "PCR reactions set up and amplification conditions" Online Publication (2011)
PCR QT-EVE-BN-006.pdf
Reference Position 1-113
Cross-references
GMOMETHODS QT-TAX-BN-012;
Features
Key Location Qualifier Value
STS 1..113 standard_namePCR 113 bp amplicon
noteevent-specific RT-PCR
target5'integration border region (IBR) between the insert of oilseed rape event RF1 and the oilseed rape host genome
primer_b 1..22 standard_namePrimer forward: MDB118
noteCTAAGGGAGGTCAAGATGTAGC
target5'-host genome
primer_b 66..92 standard_nameRT-PCR probe: TM022
noteFAM-CTCATCATCCTCACCCAGTCAGCATCA-TAMRA
primer_b complement(94..113) standard_namePrimer reverse: KVM170
noteCGGGCCTAACTTTTGGTGTG
targetinsert
Sequence information
Length: 113 BP, A Count: 31, C Count: 35, T Count: 24, G Count: 23
ctaagggagg tcaagatgta gcnnnnnnnn aacccttttc catcttttcc ggtgactaca        60
nnnnnctcat catcctcacc cagtcagcat cancacacca aaagttaggc ccg              113