European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-BN-005;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier ACS-BN004-7
Description
Description Quantitative PCR method for detection of oilseed rape event Ms1 (verified by the EU-RL GMFF in the context of Commission Decision 2007/305/EC)
Keywords event_specific, EU-RL_GMFF_in-house_verified.
From Brassica napus (oilseed rape) - event Ms1 (ACS-BN004-7)
References
1 Savini C., ; "In-house Validation of an Event-specific Method for the Quantification of Oilseed Rape MS1 Using Real-time PCR - Validation Report and Protocol" Online Publication (2011)
EURL_GMFF CRLVL1104 VR.pdf
EURL_GMFF CRLVL1104 VP.pdf
Reference Position 1-187
2 "PCR reactions set up and amplification conditions" Online Publication (2011)
PCR QT-EVE-BN-005.pdf
Reference Position 1-187
Cross-references
GMOMETHODS QT-TAX-BN-012;
Features
Key Location Qualifier Value
STS 1..187 standard_namePCR 187 bp amplicon
noteevent-specific RT-PCR
target3'integration border region (IBR) between the insert of oilseed rape event Ms1 and the oilseed rape host genome
primer_b 1..20 standard_namePrimer forward: MLD025
noteACGCTGCGGACATCTACATT
targetinsert
primer_b 79..105 standard_nameRT-PCR probe: TM030
noteFAM-CTCATTGCTGATCCACCTAGCCGACTT-TAMRA
primer_b complement(166..187) standard_namePrimer reverse: MDB175
noteCTAGATCGGAAGCTGAAGATGG
target3'-host genome
Sequence information
Length: 187 BP, A Count: 53, C Count: 50, T Count: 63, G Count: 21
acgctgcgga catctacatt nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
nnnnnnnnnn nnnnnnnnct cattgctgat ccacctagcc gacttnnnnn nnnnnnnnnn       120
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnccatc ttcagcttcc       180
gatctag                                                                 187