European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-BN-004;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier MON-00073-7
Description
Description Quantitative PCR method for detection of oilseed rape event GT73 (Mazzara et al., 2007).
Keywords event_specific.
From Brassica napus (oilseed rape) - event GT73 (MON-00073-7)
References
1 Mazzara M., Grazioli E., Savini C., Van Den Eede G.; Event-Specific Method for the Quantification of Oilseed Rape Line RT73 Using Real-Time PCR - Validation Report and Protocol - Seeds Sampling and DNA Extraction of Oilseed Rape Online Publication (2007)
DOI 10.2788/33974
Reference Position 1-108
2 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QT-EVE-BN-004.pdf
Reference Position 1-108
Cross-references
GMOMETHODS QT-TAX-BN-012;
Features
Key Location Qualifier Value
STS 1..108 standard_namePCR 108 bp amplicon
noteevent-specific RT-PCR
target3' integration border region (IBR) between the insert of oilseed rape event GT73 and the oilseed rape host genome
primer_b 1..26 standard_namePrimer forward: RT73 primer 1
noteCCATATTGACCATCATACTCATTGCT
targetinsert
primer_b 40..66 standard_nameRT-PCR probe: RT73 Probe
noteFAM-TTCCCGGACATGAAGATCATCCTCCTT-TAMRA
primer_b complement(85..108) standard_namePrimer reverse: RT73 primer 2
noteGCTTATACGAAGGCAAGAAAAGGA
target3'-host genome
Sequence information
Length: 108 BP, A Count: 16, C Count: 24, T Count: 28, G Count: 9
ccatattgac catcatactc attgctnnnn nnnnnnnnnt tcccggacat gaagatcatc        60
ctccttnnnn nnnnnnnnnn nnnntccttt tcttgccttc gtataagc                    108