European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-BN-001;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier ACS-BN008-2
Description
Description Quantitative PCR method for detection of oilseed rape event T45 (Charles Delobel et al., 2006).
Keywords event_specific.
From Brassica napus (oilseed rape) - event T45 (ACS-BN008-2)
References
1 Charles Delobel C., Bogni A., Mazzara M., Savini C., Van Den Eede G.; "Event-specific Method for the Quantification of Oilseed Rape Line T45 Using Real-time PCR - Validation Report and Protocol - Sampling and DNA Extraction of Oilseed Rape" Online Publication (2006)
DOI 10.2788/30936
Reference Position 1-123
2 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QT-EVE-BN-001.pdf
Reference Position 1-123
Cross-references
GMOMETHODS QT-TAX-BN-012;
Features
Key Location Qualifier Value
STS 1..123 standard_namePCR 123 bp amplicon
noteevent-specific RT-PCR
target5' integration border region (IBR) between the insert of oilseed rape event T45 and the oilseed rape host genome
primer_b 1..21 standard_namePrimer forward: KVM172
noteCAATGGACACATGAATTATGC
target5'-host genome
primer_b 70..94 standard_nameRT-PCR probe: TM026 probe
noteFAM-TAGAGGACCTAACAGAACTCGCCGT-TAMRA
primer_b complement(103..123) standard_namePrimer reverse: MDB599
noteGACTCTGTATGAACTGTTCGC
targetinsert
Sequence information
Length: 123 BP, A Count: 23, C Count: 16, T Count: 13, G Count: 15
caatggacac atgaattatg cnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
nnnnnnnnnt agaggaccta acagaactcg ccgtnnnnnn nngcgaacag ttcatacaga       120
gtc                                                                     123